This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00002441


Marker Name:  S0088 
Species:  Pig
Marker Type:  Microsatellite
Publication ID: 8138161

PCR Primers

Primer: AGCTGACTTTTGAAAGCAGTGCTC
Primer: AGTCACCTCTAGGCGTGATCAGCT
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00008283

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL52PRE Sscrofa8 Pig Assembly: 15 Pig
chromosome 15
59162475.000 59162549.000 59162623.000
ENSEMBL56 Sscrofa9 Pig Assembly: 15 Pig
chromosome 15
69881957.000 69882031.000 69882105.000
ENSEMBL67 Ssc10.2 Pig Assembly: 15 Pig
chromosome 15
83235996.000 83236070.000 83236144.000
Fontanesi, L et al 2000 (A): 15 Pig
chromosome 15
46.200 46.200 46.200
Milan, D et al 1996 (A): 15 Pig
chromosome 15
50.000 50.000 50.000
Milan, D et al 1996 (F): 15 Pig
chromosome 15
59.000 59.000 59.000
Milan, D et al 1996 (M): 15 Pig
chromosome 15
38.000 38.000 38.000
Nordic v1 (A): 15 Pig
chromosome 15
37.000 37.000 37.000
Nordic v2 (A): 15 Pig
chromosome 15
41.800 41.800 41.800
Nordic v2 (F): 15 Pig
chromosome 15
57.700 57.700 57.700
Nordic v2 (M): 15 Pig
chromosome 15
28.900 28.900 28.900
PiGMaP v1 (A): 15 Pig
chromosome 15
49.000 49.000 49.000
PiGMaP v1 (F): 15 Pig
chromosome 15
108.000 108.000 108.000
PiGMaP v1 (M): 15 Pig
chromosome 15
23.000 23.000 23.000
Sun, HS et al 1998 (A): 15 Pig
chromosome 15
7.500 7.500 7.500
USDA-MARC v1 (A): 15 Pig
chromosome 15
60.900 60.900 60.900
USDA-MARC v2 (A): 15 Pig
chromosome 15
52.600 52.600 52.600


© The Roslin Institute 2007-2012, all rights reserved