This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00003908


Marker Name:  SWR1120 
Species:  Pig
Marker Type:  Microsatellite
Publication ID: 8138161

PCR Primers

Primer: CAAATGGAACCCATTACAGTCC
Primer: ACTCCTAGCCCAGGAGCTTC
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00009018
has an Associated Sequence: Local Sequence ID: ARKFSQ00009019

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL52PRE Sscrofa8 Pig Assembly: 17 Pig
chromosome 17
11571453.000 11571530.000 11571607.000
ENSEMBL52PRE Sscrofa8 Pig Assembly: 17 Pig
chromosome 17
11359904.000 11359991.000 11360078.000
ENSEMBL56 Sscrofa9 Pig Assembly: 17 Pig
chromosome 17
13225057.000 13225144.000 13225231.000
ENSEMBL56 Sscrofa9 Pig Assembly: 17 Pig
chromosome 17
13422286.000 13422363.000 13422440.000
ENSEMBL67 Ssc10.2 Pig Assembly: 17 Pig
chromosome 17
14639993.000 14640080.000 14640167.000
NIAI-Japan QTL v2 (A): 17 Pig
chromosome 17
9.500 9.500 9.500
NIAI-Japan v1 (A): 17 Pig
chromosome 17
9.700 9.700 9.700
NIAI-Japan v1 (F): 17 Pig
chromosome 17
14.700 14.700 14.700
NIAI-Japan v1 (M): 17 Pig
chromosome 17
4.100 4.100 4.100
USDA-MARC current (A): 17 Pig
chromosome 17
26.900 26.900 26.900
USDA-MARC v1 (A): 17 Pig
chromosome 17
28.400 28.400 28.400
USDA-MARC v2 (A): 17 Pig
chromosome 17
26.900 26.900 26.900


© The Roslin Institute 2007-2012, all rights reserved