This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012150


Marker Name:  RM0044 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 11435411

PCR Primers

Primer: AAAGTGTTGGACATGACTGAAT
Primer: TTAACAATTAGCAACAGGAATAGAG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: U10388

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM3 (A): 21 Sheep
chromosome 21
21.600 21.600 21.600
SM3 Best Positions (A): 21 Sheep
chromosome 21
22.100 22.100 22.100
SM3 Best Positions (F): 21 Sheep
chromosome 21
12.600 12.600 12.600
SM3 Best Positions (M): 21 Sheep
chromosome 21
29.500 29.500 29.500
SM3 Framework (F): 21 Sheep
chromosome 21
12.100 12.100 12.100
SM3 Framework (M): 21 Sheep
chromosome 21
28.900 28.900 28.900
SM4 Best Positions (A): 21 Sheep
chromosome 21
22.100 22.100 22.100
SM4 Framework (A): 21 Sheep
chromosome 21
21.900 21.900 21.900
SM4 Framework (F): 21 Sheep
chromosome 21
12.300 12.300 12.300
SM4 Framework (M): 21 Sheep
chromosome 21
29.200 29.200 29.200
SM4.2 Best Positions (A): 21 Sheep
chromosome 21
22.100 22.100 22.100
SM4.2 Best Positions (F): 21 Sheep
chromosome 21
12.600 12.600 12.600
SM4.2 Best Positions (M): 21 Sheep
chromosome 21
29.500 29.500 29.500
SM4.2 Framework (A): 21 Sheep
chromosome 21
21.900 21.900 21.900
SM4.2 Framework (F): 21 Sheep
chromosome 21
12.300 12.300 12.300
SM4.2 Framework (M): 21 Sheep
chromosome 21
29.200 29.200 29.200


© The Roslin Institute 2007-2012, all rights reserved