This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012073


Marker Name:  OPCML 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 7498748

PCR Primers

Primer: CCTGACTATAATGTACAGATCCCTC
Primer: GCAGAATGACTAGGAAGGATGGCA
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM1 (A): 21 Sheep
chromosome 21
43.600 43.600 43.600
SM2 (A): 21 Sheep
chromosome 21
52.900 52.900 52.900
SM3 (A): 21 Sheep
chromosome 21
48.700 48.700 48.700
SM3 Best Positions (A): 21 Sheep
chromosome 21
47.600 47.600 47.600
SM3 Best Positions (F): 21 Sheep
chromosome 21
38.400 38.400 38.400
SM3 Best Positions (M): 21 Sheep
chromosome 21
54.300 54.300 54.300
SM3 Framework (F): 21 Sheep
chromosome 21
40.200 40.200 40.200
SM3 Framework (M): 21 Sheep
chromosome 21
55.000 55.000 55.000
SM4 Best Positions (A): 21 Sheep
chromosome 21
46.700 46.700 46.700
SM4 Framework (A): 21 Sheep
chromosome 21
47.500 47.500 47.500
SM4 Framework (F): 21 Sheep
chromosome 21
40.600 40.600 40.600
SM4 Framework (M): 21 Sheep
chromosome 21
53.500 53.500 53.500
SM4.2 Best Positions (A): 21 Sheep
chromosome 21
46.700 46.700 46.700
SM4.2 Best Positions (F): 21 Sheep
chromosome 21
37.900 37.900 37.900
SM4.2 Best Positions (M): 21 Sheep
chromosome 21
53.300 53.300 53.300
SM4.2 Framework (A): 21 Sheep
chromosome 21
47.500 47.500 47.500
SM4.2 Framework (F): 21 Sheep
chromosome 21
40.600 40.600 40.600
SM4.2 Framework (M): 21 Sheep
chromosome 21
53.500 53.500 53.500
SMC (A): 21 Sheep
chromosome 21
52.900 52.900 52.900


© The Roslin Institute 2007-2012, all rights reserved