This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00011803


Marker Name:  MCMA0054 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 11435411

PCR Primers

Primer: AACGTCCATCAGTAGATGAATGG
Primer: GTAGCATGATGTCTTGGCCACT
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM3 Best Positions (A): 21 Sheep
chromosome 21
51.600 51.600 51.600
SM3 Best Positions (F): 21 Sheep
chromosome 21
42.300 42.300 42.300
SM3 Best Positions (M): 21 Sheep
chromosome 21
58.800 58.800 58.800
SM4 Best Positions (A): 21 Sheep
chromosome 21
50.500 50.500 50.500
SM4 Framework (A): 21 Sheep
chromosome 21
50.800 50.800 50.800
SM4 Framework (F): 21 Sheep
chromosome 21
41.300 41.300 41.300
SM4 Framework (M): 21 Sheep
chromosome 21
58.000 58.000 58.000
SM4.2 Best Positions (A): 21 Sheep
chromosome 21
50.500 50.500 50.500
SM4.2 Best Positions (F): 21 Sheep
chromosome 21
41.600 41.600 41.600
SM4.2 Best Positions (M): 21 Sheep
chromosome 21
57.800 57.800 57.800
SM4.2 Framework (A): 21 Sheep
chromosome 21
50.800 50.800 50.800
SM4.2 Framework (F): 21 Sheep
chromosome 21
41.300 41.300 41.300
SM4.2 Framework (M): 21 Sheep
chromosome 21
58.000 58.000 58.000


© The Roslin Institute 2007-2012, all rights reserved