This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00011765


Marker Name:  MCM0541 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 11435411

PCR Primers

Primer: CCAACCTCCATCCACTTGTTG
Primer: CAGAGGTGGGAGATTCACC
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM3 (A): 21 Sheep
chromosome 21
66.700 66.700 66.700
SM3 Best Positions (A): 21 Sheep
chromosome 21
68.500 68.500 68.500
SM3 Best Positions (F): 21 Sheep
chromosome 21
55.300 55.300 55.300
SM3 Best Positions (M): 21 Sheep
chromosome 21
79.500 79.500 79.500
SM3 Framework (F): 21 Sheep
chromosome 21
54.100 54.100 54.100
SM3 Framework (M): 21 Sheep
chromosome 21
78.100 78.100 78.100
SM4 Best Positions (A): 21 Sheep
chromosome 21
67.600 67.600 67.600
SM4 Framework (A): 21 Sheep
chromosome 21
65.700 65.700 65.700
SM4 Framework (F): 21 Sheep
chromosome 21
52.900 52.900 52.900
SM4 Framework (M): 21 Sheep
chromosome 21
77.800 77.800 77.800
SM4.2 Best Positions (A): 21 Sheep
chromosome 21
67.600 67.600 67.600
SM4.2 Best Positions (F): 21 Sheep
chromosome 21
54.400 54.400 54.400
SM4.2 Best Positions (M): 21 Sheep
chromosome 21
78.900 78.900 78.900
SM4.2 Framework (A): 21 Sheep
chromosome 21
65.700 65.700 65.700
SM4.2 Framework (F): 21 Sheep
chromosome 21
52.900 52.900 52.900
SM4.2 Framework (M): 21 Sheep
chromosome 21
77.800 77.800 77.800


© The Roslin Institute 2007-2012, all rights reserved