This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00011579


Marker Name:  JP0015 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 7498748

PCR Primers

Primer: GGAAATACCTTATCTTTCATTCTTGACTGTGG
Primer: CCTTCTTTCTCATTGCTAACTTATATTAAATATCC
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM1 (A): 21 Sheep
chromosome 21
26.600 26.600 26.600
SM2 (A): 21 Sheep
chromosome 21
35.000 35.000 35.000
SM3 (A): 21 Sheep
chromosome 21
30.800 30.800 30.800
SM3 Best Positions (A): 21 Sheep
chromosome 21
31.600 31.600 31.600
SM3 Best Positions (F): 21 Sheep
chromosome 21
23.000 23.000 23.000
SM3 Best Positions (M): 21 Sheep
chromosome 21
36.500 36.500 36.500
SM3 Framework (F): 21 Sheep
chromosome 21
22.800 22.800 22.800
SM3 Framework (M): 21 Sheep
chromosome 21
34.800 34.800 34.800
SM4 Best Positions (A): 21 Sheep
chromosome 21
30.900 30.900 30.900
SM4 Framework (A): 21 Sheep
chromosome 21
31.000 31.000 31.000
SM4 Framework (F): 21 Sheep
chromosome 21
24.000 24.000 24.000
SM4 Framework (M): 21 Sheep
chromosome 21
36.600 36.600 36.600
SM4.2 Best Positions (A): 21 Sheep
chromosome 21
30.900 30.900 30.900
SM4.2 Best Positions (F): 21 Sheep
chromosome 21
23.700 23.700 23.700
SM4.2 Best Positions (M): 21 Sheep
chromosome 21
36.800 36.800 36.800
SM4.2 Framework (A): 21 Sheep
chromosome 21
31.000 31.000 31.000
SM4.2 Framework (F): 21 Sheep
chromosome 21
24.000 24.000 24.000
SM4.2 Framework (M): 21 Sheep
chromosome 21
36.600 36.600 36.600
SMC (A): 21 Sheep
chromosome 21
35.000 35.000 35.000


© The Roslin Institute 2007-2012, all rights reserved