This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00011417


Marker Name:  ILSTS0019 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 7498748

PCR Primers

Primer: AAGGGACCTCATGTAGAAGC
Primer: ACTTTTGGACCCTGTAGTGC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: L23492

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM1 (A): 21 Sheep
chromosome 21
0.100 0.100 0.100
SM2 (A): 21 Sheep
chromosome 21
7.700 7.700 7.700
SM3 (A): 21 Sheep
chromosome 21
6.200 6.200 6.200
SM3 Best Positions (A): 21 Sheep
chromosome 21
6.200 6.200 6.200
SM3 Best Positions (F): 21 Sheep
chromosome 21
0.000 0.000 0.000
SM3 Best Positions (M): 21 Sheep
chromosome 21
10.500 10.500 10.500
SM3 Framework (F): 21 Sheep
chromosome 21
0.000 0.000 0.000
SM3 Framework (M): 21 Sheep
chromosome 21
10.500 10.500 10.500
SM4 Best Positions (A): 21 Sheep
chromosome 21
6.200 6.200 6.200
SM4 Framework (A): 21 Sheep
chromosome 21
6.200 6.200 6.200
SM4 Framework (F): 21 Sheep
chromosome 21
0.000 0.000 0.000
SM4 Framework (M): 21 Sheep
chromosome 21
10.500 10.500 10.500
SM4.2 Best Positions (A): 21 Sheep
chromosome 21
6.200 6.200 6.200
SM4.2 Best Positions (F): 21 Sheep
chromosome 21
0.000 0.000 0.000
SM4.2 Best Positions (M): 21 Sheep
chromosome 21
10.500 10.500 10.500
SM4.2 Framework (A): 21 Sheep
chromosome 21
6.200 6.200 6.200
SM4.2 Framework (F): 21 Sheep
chromosome 21
0.000 0.000 0.000
SM4.2 Framework (M): 21 Sheep
chromosome 21
10.500 10.500 10.500
SMC (A): 21 Sheep
chromosome 21
7.700 7.700 7.700


© The Roslin Institute 2007-2012, all rights reserved