This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00011171


Marker Name:  DDB1 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: not available  

PCR Primers

Primer: GAGCAGTTTTGCAGCTCTTTGGAT
Primer: GCAACAGAAGAAAGCAAAGGAAGCT
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AW447104

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM4 Best Positions (A): 21 Sheep
chromosome 21
53.900 53.900 53.900
SM4 Framework (A): 21 Sheep
chromosome 21
54.200 54.200 54.200
SM4 Framework (F): 21 Sheep
chromosome 21
47.900 47.900 47.900
SM4 Framework (M): 21 Sheep
chromosome 21
59.400 59.400 59.400
SM4.2 Best Positions (A): 21 Sheep
chromosome 21
53.900 53.900 53.900
SM4.2 Best Positions (F): 21 Sheep
chromosome 21
47.700 47.700 47.700
SM4.2 Best Positions (M): 21 Sheep
chromosome 21
59.200 59.200 59.200
SM4.2 Framework (A): 21 Sheep
chromosome 21
54.200 54.200 54.200
SM4.2 Framework (F): 21 Sheep
chromosome 21
47.900 47.900 47.900
SM4.2 Framework (M): 21 Sheep
chromosome 21
59.400 59.400 59.400
SM4.6 Best Positions (A): 21 Sheep
chromosome 21
55.200 55.200 55.200
SM4.6 Best Positions (F): 21 Sheep
chromosome 21
54.100 54.100 54.100
SM4.6 Best Positions (M): 21 Sheep
chromosome 21
57.000 57.000 57.000
SM4.7 Best Positions (A): 21 Sheep
chromosome 21
55.200 55.200 55.200


© The Roslin Institute 2007-2012, all rights reserved