This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00011125


Marker Name:  CSSM0013 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 7498748

PCR Primers

Primer: ATAAGAGATTACCCTTCCTGACTG
Primer: AGGTAAATGTTCCTATTTGCTAAC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: U03841

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM1 (A): 21 Sheep
chromosome 21
10.000 10.000 10.000
SM2 (A): 21 Sheep
chromosome 21
17.500 17.500 17.500
SM3 (A): 21 Sheep
chromosome 21
15.400 15.400 15.400
SM3 Best Positions (A): 21 Sheep
chromosome 21
15.500 15.500 15.500
SM3 Best Positions (F): 21 Sheep
chromosome 21
6.700 6.700 6.700
SM3 Best Positions (M): 21 Sheep
chromosome 21
22.300 22.300 22.300
SM3 Framework (F): 21 Sheep
chromosome 21
6.000 6.000 6.000
SM3 Framework (M): 21 Sheep
chromosome 21
22.300 22.300 22.300
SM4 Best Positions (A): 21 Sheep
chromosome 21
15.500 15.500 15.500
SM4 Framework (A): 21 Sheep
chromosome 21
15.500 15.500 15.500
SM4 Framework (F): 21 Sheep
chromosome 21
6.100 6.100 6.100
SM4 Framework (M): 21 Sheep
chromosome 21
22.300 22.300 22.300
SM4.2 Best Positions (A): 21 Sheep
chromosome 21
15.500 15.500 15.500
SM4.2 Best Positions (F): 21 Sheep
chromosome 21
6.700 6.700 6.700
SM4.2 Best Positions (M): 21 Sheep
chromosome 21
22.300 22.300 22.300
SM4.2 Framework (A): 21 Sheep
chromosome 21
15.500 15.500 15.500
SM4.2 Framework (F): 21 Sheep
chromosome 21
6.100 6.100 6.100
SM4.2 Framework (M): 21 Sheep
chromosome 21
22.300 22.300 22.300
SMC (A): 21 Sheep
chromosome 21
17.500 17.500 17.500


© The Roslin Institute 2007-2012, all rights reserved