This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00011049


Marker Name:  CSAP0030E 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: not available  

PCR Primers

Primer: AGTTCAGGCCCCACACCACTAC
Primer: GTCAGAGACAGCTGGCAGAGTAAGA
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: CF115550

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM4 Best Positions (A): 21 Sheep
chromosome 21
29.100 29.100 29.100
SM4 Framework (A): 21 Sheep
chromosome 21
29.300 29.300 29.300
SM4 Framework (F): 21 Sheep
chromosome 21
22.800 22.800 22.800
SM4 Framework (M): 21 Sheep
chromosome 21
34.100 34.100 34.100
SM4.2 Best Positions (A): 21 Sheep
chromosome 21
29.100 29.100 29.100
SM4.2 Best Positions (F): 21 Sheep
chromosome 21
22.500 22.500 22.500
SM4.2 Best Positions (M): 21 Sheep
chromosome 21
34.100 34.100 34.100
SM4.2 Framework (A): 21 Sheep
chromosome 21
29.300 29.300 29.300
SM4.2 Framework (F): 21 Sheep
chromosome 21
22.800 22.800 22.800
SM4.2 Framework (M): 21 Sheep
chromosome 21
34.100 34.100 34.100


© The Roslin Institute 2007-2012, all rights reserved