This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00010697


Marker Name:  BMC3224 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 7498748

PCR Primers

Primer: CCATCACTGCTATTCTACCTCC
Primer: CACAGCCAATTTCTGATTTCA
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM1 (A): 21 Sheep
chromosome 21
42.000 42.000 42.000
SM2 (A): 21 Sheep
chromosome 21
51.100 51.100 51.100
SM3 (A): 21 Sheep
chromosome 21
47.100 47.100 47.100
SM3 Best Positions (A): 21 Sheep
chromosome 21
45.700 45.700 45.700
SM3 Best Positions (F): 21 Sheep
chromosome 21
36.800 36.800 36.800
SM3 Best Positions (M): 21 Sheep
chromosome 21
52.200 52.200 52.200
SM3 Framework (F): 21 Sheep
chromosome 21
37.900 37.900 37.900
SM3 Framework (M): 21 Sheep
chromosome 21
53.900 53.900 53.900
SM4 Best Positions (A): 21 Sheep
chromosome 21
44.700 44.700 44.700
SM4 Framework (A): 21 Sheep
chromosome 21
45.800 45.800 45.800
SM4 Framework (F): 21 Sheep
chromosome 21
37.500 37.500 37.500
SM4 Framework (M): 21 Sheep
chromosome 21
52.300 52.300 52.300
SM4.2 Best Positions (A): 21 Sheep
chromosome 21
44.700 44.700 44.700
SM4.2 Best Positions (F): 21 Sheep
chromosome 21
36.400 36.400 36.400
SM4.2 Best Positions (M): 21 Sheep
chromosome 21
51.200 51.200 51.200
SM4.2 Framework (A): 21 Sheep
chromosome 21
45.800 45.800 45.800
SM4.2 Framework (F): 21 Sheep
chromosome 21
37.500 37.500 37.500
SM4.2 Framework (M): 21 Sheep
chromosome 21
52.300 52.300 52.300
SM4.6 Best Positions (A): 21 Sheep
chromosome 21
46.000 46.000 46.000
SM4.6 Best Positions (F): 21 Sheep
chromosome 21
42.800 42.800 42.800
SM4.6 Best Positions (M): 21 Sheep
chromosome 21
49.000 49.000 49.000
SM4.7 Best Positions (A): 21 Sheep
chromosome 21
46.000 46.000 46.000
SMC (A): 21 Sheep
chromosome 21
51.100 51.100 51.100


© The Roslin Institute 2007-2012, all rights reserved