This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012098


Marker Name:  POLB 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: not available  

PCR Primers

Primer: CGTTAAGGTTGTTGCATACTCCTGT
Primer: CTCTTCAGCCAAAGTCAAGGAAT
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM4 Best Positions (A): 26 Sheep
chromosome 26
61.500 61.500 61.500
SM4 Framework (A): 26 Sheep
chromosome 26
60.800 60.800 60.800
SM4 Framework (F): 26 Sheep
chromosome 26
51.500 51.500 51.500
SM4 Framework (M): 26 Sheep
chromosome 26
70.800 70.800 70.800
SM4.2 Best Positions (A): 26 Sheep
chromosome 26
61.500 61.500 61.500
SM4.2 Best Positions (F): 26 Sheep
chromosome 26
53.200 53.200 53.200
SM4.2 Best Positions (M): 26 Sheep
chromosome 26
70.700 70.700 70.700
SM4.2 Framework (A): 26 Sheep
chromosome 26
60.800 60.800 60.800
SM4.2 Framework (F): 26 Sheep
chromosome 26
51.500 51.500 51.500
SM4.2 Framework (M): 26 Sheep
chromosome 26
70.800 70.800 70.800


© The Roslin Institute 2007-2012, all rights reserved