This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00011926


Marker Name:  MTNR1A 
Species:  Sheep
Marker Type:  PCR-RFLP
Publication ID: 11435411

PCR Primers

Primer: TGTGTTTGTGGTGAGCCTGG
Primer: ATGGAGAGGGTTTGCGTTTA
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: U14109

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM3 Best Positions (A): 26 Sheep
chromosome 26
21.700 21.700 21.700
SM3 Best Positions (F): 26 Sheep
chromosome 26
10.500 10.500 10.500
SM3 Best Positions (M): 26 Sheep
chromosome 26
34.000 34.000 34.000
SM4 Best Positions (A): 26 Sheep
chromosome 26
21.700 21.700 21.700
SM4.2 Best Positions (A): 26 Sheep
chromosome 26
21.700 21.700 21.700
SM4.2 Best Positions (F): 26 Sheep
chromosome 26
10.500 10.500 10.500
SM4.2 Best Positions (M): 26 Sheep
chromosome 26
34.000 34.000 34.000
SM4.6 Best Positions (A): 26 Sheep
chromosome 26
21.700 21.700 21.700
SM4.6 Best Positions (F): 26 Sheep
chromosome 26
10.500 10.500 10.500
SM4.6 Best Positions (M): 26 Sheep
chromosome 26
34.000 34.000 34.000
SM4.7 Best Positions (A): 26 Sheep
chromosome 26
21.700 21.700 21.700
SMC (A): 26 Sheep
chromosome 26
11.000 11.000 11.000


© The Roslin Institute 2007-2012, all rights reserved