This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00011117


Marker Name:  CSRD2163 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 11435411

PCR Primers

Primer: ATCTCCTGCCTGGTTTCCTCAAAC
Primer: TTCATATCACTCTGGTGCTGGTGC
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM3 (A): 26 Sheep
chromosome 26
36.600 36.600 36.600
SM3 Best Positions (A): 26 Sheep
chromosome 26
39.000 39.000 39.000
SM3 Best Positions (F): 26 Sheep
chromosome 26
29.000 29.000 29.000
SM3 Best Positions (M): 26 Sheep
chromosome 26
51.700 51.700 51.700
SM3 Framework (F): 26 Sheep
chromosome 26
25.200 25.200 25.200
SM3 Framework (M): 26 Sheep
chromosome 26
52.300 52.300 52.300
SM4 Best Positions (A): 26 Sheep
chromosome 26
39.000 39.000 39.000
SM4 Framework (A): 26 Sheep
chromosome 26
36.500 36.500 36.500
SM4 Framework (F): 26 Sheep
chromosome 26
25.100 25.100 25.100
SM4 Framework (M): 26 Sheep
chromosome 26
52.300 52.300 52.300
SM4.2 Best Positions (A): 26 Sheep
chromosome 26
39.000 39.000 39.000
SM4.2 Best Positions (F): 26 Sheep
chromosome 26
29.000 29.000 29.000
SM4.2 Best Positions (M): 26 Sheep
chromosome 26
51.700 51.700 51.700
SM4.2 Framework (A): 26 Sheep
chromosome 26
36.500 36.500 36.500
SM4.2 Framework (F): 26 Sheep
chromosome 26
25.100 25.100 25.100
SM4.2 Framework (M): 26 Sheep
chromosome 26
52.300 52.300 52.300


© The Roslin Institute 2007-2012, all rights reserved