This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00011096


Marker Name:  CSRD0280 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 11435411

PCR Primers

Primer: CCAAGTCTGCTTTCCATGGGCTGA
Primer: AATGTCTGAGAGAGAGTCTGGCCA
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM3 Best Positions (A): 26 Sheep
chromosome 26
20.600 20.600 20.600
SM3 Best Positions (F): 26 Sheep
chromosome 26
10.500 10.500 10.500
SM3 Best Positions (M): 26 Sheep
chromosome 26
32.900 32.900 32.900
SM4 Best Positions (A): 26 Sheep
chromosome 26
20.600 20.600 20.600
SM4.2 Best Positions (A): 26 Sheep
chromosome 26
20.600 20.600 20.600
SM4.2 Best Positions (F): 26 Sheep
chromosome 26
10.500 10.500 10.500
SM4.2 Best Positions (M): 26 Sheep
chromosome 26
32.900 32.900 32.900


© The Roslin Institute 2007-2012, all rights reserved