This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00010907


Marker Name:  BMS2104 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 9501303

PCR Primers

Primer: TGCCACGTCATCTTTTGAAG
Primer: GCAAGTTTGCAGGTTCTATGC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: G18921

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM2 (A): 26 Sheep
chromosome 26
2.400 2.400 2.400
SM3 Best Positions (A): 26 Sheep
chromosome 26
2.000 2.000 2.000
SM3 Best Positions (F): 26 Sheep
chromosome 26
0.000 0.000 0.000
SM3 Best Positions (M): 26 Sheep
chromosome 26
4.500 4.500 4.500
SM4 Best Positions (A): 26 Sheep
chromosome 26
2.000 2.000 2.000
SM4.2 Best Positions (A): 26 Sheep
chromosome 26
2.000 2.000 2.000
SM4.2 Best Positions (F): 26 Sheep
chromosome 26
0.000 0.000 0.000
SM4.2 Best Positions (M): 26 Sheep
chromosome 26
4.500 4.500 4.500
SM4.6 Best Positions (A): 26 Sheep
chromosome 26
2.000 2.000 2.000
SM4.6 Best Positions (F): 26 Sheep
chromosome 26
0.000 0.000 0.000
SM4.6 Best Positions (M): 26 Sheep
chromosome 26
4.500 4.500 4.500
SM4.7 Best Positions (A): 26 Sheep
chromosome 26
2.000 2.000 2.000
SMC (A): 26 Sheep
chromosome 26
2.400 2.400 2.400


© The Roslin Institute 2007-2012, all rights reserved