This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00010601


Marker Name:  BM3507 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 11435411

PCR Primers

Primer: GCCCAAAGAAAGAAGTATGTGC
Primer: TAGTGCGGAGTCAGTCATGTG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: G18516

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM3 (A): 26 Sheep
chromosome 26
5.100 5.100 5.100
SM3 Best Positions (A): 26 Sheep
chromosome 26
6.900 6.900 6.900
SM3 Best Positions (F): 26 Sheep
chromosome 26
3.300 3.300 3.300
SM3 Best Positions (M): 26 Sheep
chromosome 26
10.900 10.900 10.900
SM3 Framework (F): 26 Sheep
chromosome 26
0.000 0.000 0.000
SM3 Framework (M): 26 Sheep
chromosome 26
8.900 8.900 8.900
SM4 Best Positions (A): 26 Sheep
chromosome 26
6.900 6.900 6.900
SM4 Framework (A): 26 Sheep
chromosome 26
5.100 5.100 5.100
SM4 Framework (F): 26 Sheep
chromosome 26
0.000 0.000 0.000
SM4 Framework (M): 26 Sheep
chromosome 26
8.900 8.900 8.900
SM4.2 Best Positions (A): 26 Sheep
chromosome 26
6.900 6.900 6.900
SM4.2 Best Positions (F): 26 Sheep
chromosome 26
3.300 3.300 3.300
SM4.2 Best Positions (M): 26 Sheep
chromosome 26
10.900 10.900 10.900
SM4.2 Framework (A): 26 Sheep
chromosome 26
5.100 5.100 5.100
SM4.2 Framework (F): 26 Sheep
chromosome 26
0.000 0.000 0.000
SM4.2 Framework (M): 26 Sheep
chromosome 26
8.900 8.900 8.900


© The Roslin Institute 2007-2012, all rights reserved