This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00010515


Marker Name:  BM0203 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 7498748

PCR Primers

Primer: GGGTGTGACATTTTGTTCCC
Primer: CTGCTCGCCACTAGTCCTTC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: G18500

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM1 (A): 26 Sheep
chromosome 26
0.100 0.100 0.100
SM2 (A): 26 Sheep
chromosome 26
63.500 63.500 63.500
SM3 (A): 26 Sheep
chromosome 26
70.200 70.200 70.200
SM3 Best Positions (A): 26 Sheep
chromosome 26
70.700 70.700 70.700
SM3 Best Positions (F): 26 Sheep
chromosome 26
58.100 58.100 58.100
SM3 Best Positions (M): 26 Sheep
chromosome 26
84.300 84.300 84.300
SM3 Framework (F): 26 Sheep
chromosome 26
56.500 56.500 56.500
SM3 Framework (M): 26 Sheep
chromosome 26
84.300 84.300 84.300
SM4 Best Positions (A): 26 Sheep
chromosome 26
71.100 71.100 71.100
SM4 Framework (A): 26 Sheep
chromosome 26
70.300 70.300 70.300
SM4 Framework (F): 26 Sheep
chromosome 26
55.400 55.400 55.400
SM4 Framework (M): 26 Sheep
chromosome 26
85.800 85.800 85.800
SM4.2 Best Positions (A): 26 Sheep
chromosome 26
71.100 71.100 71.100
SM4.2 Best Positions (F): 26 Sheep
chromosome 26
57.300 57.300 57.300
SM4.2 Best Positions (M): 26 Sheep
chromosome 26
85.900 85.900 85.900
SM4.2 Framework (A): 26 Sheep
chromosome 26
70.300 70.300 70.300
SM4.2 Framework (F): 26 Sheep
chromosome 26
55.400 55.400 55.400
SM4.2 Framework (M): 26 Sheep
chromosome 26
85.800 85.800 85.800
SMC (A): 26 Sheep
chromosome 26
63.500 63.500 63.500


© The Roslin Institute 2007-2012, all rights reserved