This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00027762


Marker Name:  RHT0166 
Species:  Turkey
Marker Type:  Microsatellite
Publication ID: 14687069

PCR Primers

Primer: ATGTTTGGACAATACCCACTCC
Primer: GCCTAGCTCTGGGTTGACAG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AL592954
has an Associated Sequence: Local Sequence ID: ARKFSQ00009280

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Burt et al. 2003 (A): 9 Turkey
chromosome 9
45.000 45.000 45.000
ENSEMBL57 UMD2 Turkey Assembly: Un Turkey
chromosome
63962933.000 63963134.000 63963335.000
ENSEMBL66 Turkey_2.01 Turkey Assembly: 1 Turkey
chromosome 1
170253445.000 170253646.000 170253847.000


© The Roslin Institute 2007-2012, all rights reserved