This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00027760


Marker Name:  RHT0128 
Species:  Turkey
Marker Type:  Microsatellite
Publication ID: 14687069

PCR Primers

Primer: TTGTCTTACTGTCCCTGAATGC
Primer: TGGTTCATCATCTGCTACAACC
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00009279
has an Associated Sequence: Sequence Genbank ID: AL593134

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Burt et al. 2003 (A): 9 Turkey
chromosome 9
39.700 39.700 39.700
ENSEMBL57 UMD2 Turkey Assembly: 1 Turkey
chromosome 1
156004355.000 156004444.000 156004533.000
ENSEMBL66 Turkey_2.01 Turkey Assembly: 1 Turkey
chromosome 1
151490388.000 151490477.000 151490566.000


© The Roslin Institute 2007-2012, all rights reserved