This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012077


Marker Name:  OY0005 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 11435411

PCR Primers

Primer: CTACAGTCCACGGGCCAC
Primer: GGATAATGATAGCTCCCTGGC
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM3 (A): 18 Sheep
chromosome 18
111.400 111.400 111.400
SM3 Best Positions (A): 18 Sheep
chromosome 18
113.400 113.400 113.400
SM3 Best Positions (F): 18 Sheep
chromosome 18
102.900 102.900 102.900
SM3 Best Positions (M): 18 Sheep
chromosome 18
121.500 121.500 121.500
SM3 Framework (F): 18 Sheep
chromosome 18
105.000 105.000 105.000
SM3 Framework (M): 18 Sheep
chromosome 18
116.500 116.500 116.500
SM4 Best Positions (A): 18 Sheep
chromosome 18
118.000 118.000 118.000
SM4 Framework (A): 18 Sheep
chromosome 18
113.500 113.500 113.500
SM4 Framework (F): 18 Sheep
chromosome 18
104.300 104.300 104.300
SM4 Framework (M): 18 Sheep
chromosome 18
122.000 122.000 122.000
SM4.2 Best Positions (A): 18 Sheep
chromosome 18
118.000 118.000 118.000
SM4.2 Best Positions (F): 18 Sheep
chromosome 18
106.500 106.500 106.500
SM4.2 Best Positions (M): 18 Sheep
chromosome 18
128.700 128.700 128.700
SM4.2 Framework (A): 18 Sheep
chromosome 18
113.500 113.500 113.500
SM4.2 Framework (F): 18 Sheep
chromosome 18
104.300 104.300 104.300
SM4.2 Framework (M): 18 Sheep
chromosome 18
122.000 122.000 122.000
SMC (A): 18 Sheep
chromosome 18
87.200 87.200 87.200


© The Roslin Institute 2007-2012, all rights reserved