This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012042


Marker Name:  OARVH0054 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 7498748

PCR Primers

Primer: ATGGTTACTGAATGGCTGCCTAACCC
Primer: CCTTAGGAACTAATGTGCACTTGTATGTG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: U08879

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM1 (A): 18 Sheep
chromosome 18
64.500 64.500 64.500
SM2 (A): 18 Sheep
chromosome 18
18.800 18.800 18.800
SM3 Best Positions (A): 18 Sheep
chromosome 18
42.700 42.700 42.700
SM3 Best Positions (F): 18 Sheep
chromosome 18
46.200 46.200 46.200
SM3 Best Positions (M): 18 Sheep
chromosome 18
39.200 39.200 39.200
SM4 Best Positions (A): 18 Sheep
chromosome 18
42.900 42.900 42.900
SM4.2 Best Positions (A): 18 Sheep
chromosome 18
42.900 42.900 42.900
SM4.2 Best Positions (F): 18 Sheep
chromosome 18
46.000 46.000 46.000
SM4.2 Best Positions (M): 18 Sheep
chromosome 18
40.400 40.400 40.400
SMC (A): 18 Sheep
chromosome 18
31.800 31.800 31.800


© The Roslin Institute 2007-2012, all rights reserved