This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012008


Marker Name:  OARHH0047 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 7498748

PCR Primers

Primer: TTTATTGCAAACTCTCTTCCTAACTCCACC
Primer: GTAACTTATTTAAAAAAATATCATACCTCTTAAGG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: L12557

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM1 (A): 18 Sheep
chromosome 18
29.000 29.000 29.000
SM2 (A): 18 Sheep
chromosome 18
50.900 50.900 50.900
SM3 (A): 18 Sheep
chromosome 18
77.700 77.700 77.700
SM3 Best Positions (A): 18 Sheep
chromosome 18
77.700 77.700 77.700
SM3 Best Positions (F): 18 Sheep
chromosome 18
79.700 79.700 79.700
SM3 Best Positions (M): 18 Sheep
chromosome 18
75.300 75.300 75.300
SM3 Framework (F): 18 Sheep
chromosome 18
80.700 80.700 80.700
SM3 Framework (M): 18 Sheep
chromosome 18
73.900 73.900 73.900
SM4 Best Positions (A): 18 Sheep
chromosome 18
77.900 77.900 77.900
SM4 Framework (A): 18 Sheep
chromosome 18
77.800 77.800 77.800
SM4 Framework (F): 18 Sheep
chromosome 18
80.400 80.400 80.400
SM4 Framework (M): 18 Sheep
chromosome 18
75.300 75.300 75.300
SM4.2 Best Positions (A): 18 Sheep
chromosome 18
77.900 77.900 77.900
SM4.2 Best Positions (F): 18 Sheep
chromosome 18
79.500 79.500 79.500
SM4.2 Best Positions (M): 18 Sheep
chromosome 18
76.500 76.500 76.500
SM4.2 Framework (A): 18 Sheep
chromosome 18
77.800 77.800 77.800
SM4.2 Framework (F): 18 Sheep
chromosome 18
80.400 80.400 80.400
SM4.2 Framework (M): 18 Sheep
chromosome 18
75.300 75.300 75.300
SMC (A): 18 Sheep
chromosome 18
59.800 59.800 59.800


© The Roslin Institute 2007-2012, all rights reserved