This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00011723


Marker Name:  MCM0131 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 11435411

PCR Primers

Primer: ATTCACAAAGCCGCGCTTG
Primer: ATCAAGCTCCCCTCTTCGGT
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: L38976

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM3 (A): 18 Sheep
chromosome 18
17.500 17.500 17.500
SM3 Best Positions (A): 18 Sheep
chromosome 18
17.300 17.300 17.300
SM3 Best Positions (F): 18 Sheep
chromosome 18
15.900 15.900 15.900
SM3 Best Positions (M): 18 Sheep
chromosome 18
16.900 16.900 16.900
SM3 Framework (F): 18 Sheep
chromosome 18
16.000 16.000 16.000
SM3 Framework (M): 18 Sheep
chromosome 18
16.900 16.900 16.900
SM4 Best Positions (A): 18 Sheep
chromosome 18
17.800 17.800 17.800
SM4 Framework (A): 18 Sheep
chromosome 18
17.800 17.800 17.800
SM4 Framework (F): 18 Sheep
chromosome 18
16.300 16.300 16.300
SM4 Framework (M): 18 Sheep
chromosome 18
18.600 18.600 18.600
SM4.2 Best Positions (A): 18 Sheep
chromosome 18
17.800 17.800 17.800
SM4.2 Best Positions (F): 18 Sheep
chromosome 18
16.300 16.300 16.300
SM4.2 Best Positions (M): 18 Sheep
chromosome 18
18.600 18.600 18.600
SM4.2 Framework (A): 18 Sheep
chromosome 18
17.800 17.800 17.800
SM4.2 Framework (F): 18 Sheep
chromosome 18
16.300 16.300 16.300
SM4.2 Framework (M): 18 Sheep
chromosome 18
18.600 18.600 18.600


© The Roslin Institute 2007-2012, all rights reserved