This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00011128


Marker Name:  CSSM0018 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 7498748

PCR Primers

Primer: TGTGCATAATTTGTGTCCGTCCGGA
Primer: CTCGTGGTGTAGAGAAGACGCCTT
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: U03798

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM1 (A): 18 Sheep
chromosome 18
0.100 0.100 0.100
SM2 (A): 18 Sheep
chromosome 18
82.900 82.900 82.900
SM3 Best Positions (A): 18 Sheep
chromosome 18
107.400 107.400 107.400
SM3 Best Positions (F): 18 Sheep
chromosome 18
100.500 100.500 100.500
SM3 Best Positions (M): 18 Sheep
chromosome 18
113.300 113.300 113.300
SM4 Best Positions (A): 18 Sheep
chromosome 18
107.100 107.100 107.100
SM4 Framework (A): 18 Sheep
chromosome 18
108.500 108.500 108.500
SM4 Framework (F): 18 Sheep
chromosome 18
102.400 102.400 102.400
SM4 Framework (M): 18 Sheep
chromosome 18
114.400 114.400 114.400
SM4.2 Best Positions (A): 18 Sheep
chromosome 18
107.100 107.100 107.100
SM4.2 Best Positions (F): 18 Sheep
chromosome 18
100.200 100.200 100.200
SM4.2 Best Positions (M): 18 Sheep
chromosome 18
113.800 113.800 113.800
SM4.2 Framework (A): 18 Sheep
chromosome 18
108.500 108.500 108.500
SM4.2 Framework (F): 18 Sheep
chromosome 18
102.400 102.400 102.400
SM4.2 Framework (M): 18 Sheep
chromosome 18
114.400 114.400 114.400
SMC (A): 18 Sheep
chromosome 18
87.000 87.000 87.000


© The Roslin Institute 2007-2012, all rights reserved