This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00011074


Marker Name:  CSRD0223 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 11435411

PCR Primers

Primer: CATACATCGATAGCAACATTCCCC
Primer: AAATGGCAACCCACTCCAGTATTC
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM3 Best Positions (A): 18 Sheep
chromosome 18
54.000 54.000 54.000
SM3 Best Positions (F): 18 Sheep
chromosome 18
49.700 49.700 49.700
SM3 Best Positions (M): 18 Sheep
chromosome 18
54.500 54.500 54.500
SM4 Best Positions (A): 18 Sheep
chromosome 18
54.200 54.200 54.200
SM4.2 Best Positions (A): 18 Sheep
chromosome 18
54.200 54.200 54.200
SM4.2 Best Positions (F): 18 Sheep
chromosome 18
49.500 49.500 49.500
SM4.2 Best Positions (M): 18 Sheep
chromosome 18
55.800 55.800 55.800


© The Roslin Institute 2007-2012, all rights reserved