This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00010951


Marker Name:  BMS2815 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 9501303

PCR Primers

Primer: TGATATTCAAACTCAATGAACCC
Primer: CTTGCATATGCTCATCATTATCA
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: G18992

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM2 (A): 18 Sheep
chromosome 18
35.000 35.000 35.000
SM3 Best Positions (A): 18 Sheep
chromosome 18
58.700 58.700 58.700
SM3 Best Positions (F): 18 Sheep
chromosome 18
61.200 61.200 61.200
SM3 Best Positions (M): 18 Sheep
chromosome 18
56.600 56.600 56.600
SM4 Best Positions (A): 18 Sheep
chromosome 18
58.900 58.900 58.900
SM4.2 Best Positions (A): 18 Sheep
chromosome 18
58.900 58.900 58.900
SM4.2 Best Positions (F): 18 Sheep
chromosome 18
61.100 61.100 61.100
SM4.2 Best Positions (M): 18 Sheep
chromosome 18
57.900 57.900 57.900
SM4.6 Best Positions (A): 18 Sheep
chromosome 18
57.900 57.900 57.900
SM4.6 Best Positions (F): 18 Sheep
chromosome 18
56.500 56.500 56.500
SM4.6 Best Positions (M): 18 Sheep
chromosome 18
60.600 60.600 60.600
SM4.7 Best Positions (A): 18 Sheep
chromosome 18
57.900 57.900 57.900
SMC (A): 18 Sheep
chromosome 18
45.300 45.300 45.300


© The Roslin Institute 2007-2012, all rights reserved