This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00010827


Marker Name:  BMS1117 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 11435411

PCR Primers

Primer: TGTGTGCTCTCTCACACATGC
Primer: AACCAAAGCAGGGATCAGG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: G18619

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM3 (A): 18 Sheep
chromosome 18
12.500 12.500 12.500
SM3 Best Positions (A): 18 Sheep
chromosome 18
12.500 12.500 12.500
SM3 Best Positions (F): 18 Sheep
chromosome 18
13.700 13.700 13.700
SM3 Best Positions (M): 18 Sheep
chromosome 18
8.800 8.800 8.800
SM3 Framework (F): 18 Sheep
chromosome 18
13.700 13.700 13.700
SM3 Framework (M): 18 Sheep
chromosome 18
8.800 8.800 8.800
SM4 Best Positions (A): 18 Sheep
chromosome 18
12.700 12.700 12.700
SM4 Framework (A): 18 Sheep
chromosome 18
12.700 12.700 12.700
SM4 Framework (F): 18 Sheep
chromosome 18
13.100 13.100 13.100
SM4 Framework (M): 18 Sheep
chromosome 18
11.300 11.300 11.300
SM4.2 Best Positions (A): 18 Sheep
chromosome 18
12.700 12.700 12.700
SM4.2 Best Positions (F): 18 Sheep
chromosome 18
13.100 13.100 13.100
SM4.2 Best Positions (M): 18 Sheep
chromosome 18
11.300 11.300 11.300
SM4.2 Framework (A): 18 Sheep
chromosome 18
12.700 12.700 12.700
SM4.2 Framework (F): 18 Sheep
chromosome 18
13.100 13.100 13.100
SM4.2 Framework (M): 18 Sheep
chromosome 18
11.300 11.300 11.300
SMC (A): 18 Sheep
chromosome 18
3.600 3.600 3.600


© The Roslin Institute 2007-2012, all rights reserved