This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00010699


Marker Name:  BMC5221 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 9501303

PCR Primers

Primer: AGCAAGGAGAACAGGCATTC
Primer: CTTCTTTGGCAGCACAGTTTC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: G19096

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Beraldi, Dario et al 2006 (A): 18 Sheep
chromosome 18
49.400 49.400 49.400
SM2 (A): 18 Sheep
chromosome 18
50.900 50.900 50.900
SM3 Best Positions (A): 18 Sheep
chromosome 18
77.700 77.700 77.700
SM3 Best Positions (F): 18 Sheep
chromosome 18
79.700 79.700 79.700
SM3 Best Positions (M): 18 Sheep
chromosome 18
75.300 75.300 75.300
SM4 Best Positions (A): 18 Sheep
chromosome 18
77.900 77.900 77.900
SM4.2 Best Positions (A): 18 Sheep
chromosome 18
77.900 77.900 77.900
SM4.2 Best Positions (F): 18 Sheep
chromosome 18
79.500 79.500 79.500
SM4.2 Best Positions (M): 18 Sheep
chromosome 18
76.500 76.500 76.500
SM4.6 Best Positions (A): 18 Sheep
chromosome 18
77.000 77.000 77.000
SM4.6 Best Positions (F): 18 Sheep
chromosome 18
75.000 75.000 75.000
SM4.6 Best Positions (M): 18 Sheep
chromosome 18
79.200 79.200 79.200
SM4.7 Best Positions (A): 18 Sheep
chromosome 18
77.000 77.000 77.000
SMC (A): 18 Sheep
chromosome 18
58.100 58.100 58.100


© The Roslin Institute 2007-2012, all rights reserved