This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00010599


Marker Name:  BM3413 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 7498748

PCR Primers

Primer: TCCCTGGTAACCAATGAATTC
Primer: CAATGGATTTGACCCTCCC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: G18492

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Beraldi, Dario et al 2006 (A): 18 Sheep
chromosome 18
0.000 0.000 0.000
SM1 (A): 18 Sheep
chromosome 18
82.000 82.000 82.000
SM2 (A): 18 Sheep
chromosome 18
0.000 0.000 0.000
SM3 (A): 18 Sheep
chromosome 18
22.100 22.100 22.100
SM3 Best Positions (A): 18 Sheep
chromosome 18
23.000 23.000 23.000
SM3 Best Positions (F): 18 Sheep
chromosome 18
20.600 20.600 20.600
SM3 Best Positions (M): 18 Sheep
chromosome 18
23.200 23.200 23.200
SM3 Framework (F): 18 Sheep
chromosome 18
20.400 20.400 20.400
SM3 Framework (M): 18 Sheep
chromosome 18
21.900 21.900 21.900
SM4 Best Positions (A): 18 Sheep
chromosome 18
23.300 23.300 23.300
SM4 Framework (A): 18 Sheep
chromosome 18
22.400 22.400 22.400
SM4 Framework (F): 18 Sheep
chromosome 18
20.500 20.500 20.500
SM4 Framework (M): 18 Sheep
chromosome 18
23.200 23.200 23.200
SM4.2 Best Positions (A): 18 Sheep
chromosome 18
23.300 23.300 23.300
SM4.2 Best Positions (F): 18 Sheep
chromosome 18
20.800 20.800 20.800
SM4.2 Best Positions (M): 18 Sheep
chromosome 18
24.400 24.400 24.400
SM4.2 Framework (A): 18 Sheep
chromosome 18
22.400 22.400 22.400
SM4.2 Framework (F): 18 Sheep
chromosome 18
20.500 20.500 20.500
SM4.2 Framework (M): 18 Sheep
chromosome 18
23.200 23.200 23.200
SM4.6 Best Positions (A): 18 Sheep
chromosome 18
22.300 22.300 22.300
SM4.6 Best Positions (F): 18 Sheep
chromosome 18
16.200 16.200 16.200
SM4.6 Best Positions (M): 18 Sheep
chromosome 18
27.100 27.100 27.100
SM4.7 Best Positions (A): 18 Sheep
chromosome 18
22.300 22.300 22.300
SMC (A): 18 Sheep
chromosome 18
12.900 12.900 12.900


© The Roslin Institute 2007-2012, all rights reserved