This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00004789


Marker Name:  ADL0262 
Species:  Chicken
Marker Type:  Microsatellite
Publication ID: 9598314

PCR Primers

Primer: GTGCAGACACAGAGGGAAAG
Primer: TCACATGCACACAGAGATGC
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00003532
has an Associated Sequence: Sequence Genbank ID: G01682

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Consensus 2000 (A): 23 Chicken
chromosome 23
0.000 0.000 0.000
Consensus 2005 (A): 23 Chicken
chromosome 23
-1.000 0.000 1.000
East Lansing (M): 23 Chicken
chromosome 23
0.000 0.000 0.000
ENSEMBL53 WASHUC2 Chicken Assembly: 23 Chicken
chromosome 23
574802.000 574854.000 574906.000
ENSEMBL71 Galgal4 Chick Assembly: 23 Chicken
chromosome 23
598951.000 599003.000 599055.000
Wageningen (A): 23 Chicken
chromosome 23
0.000 0.000 0.000
Wageningen (F): 23 Chicken
chromosome 23
0.000 0.000 0.000
Wageningen (M): 23 Chicken
chromosome 23
0.000 0.000 0.000


© The Roslin Institute 2007-2012, all rights reserved