This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00004061


Marker Name:  Sj024 
Species:  Pig
Marker Type:  Microsatellite
Publication ID: 11167524

PCR Primers

Primer: TTCCTTGCTTCAGACTTATATGCTTGC
Primer: CCAGGGGCTCAGTGGATAAGG
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
NIAI-Japan QTL v2 (A): 5 Pig
chromosome 5
0.000 0.000 0.000
NIAI-Japan v1 (A): 5 Pig
chromosome 5
0.000 0.000 0.000
NIAI-Japan v1 (F): 5 Pig
chromosome 5
0.000 0.000 0.000
NIAI-Japan v1 (M): 5 Pig
chromosome 5
0.000 0.000 0.000


© The Roslin Institute 2007-2012, all rights reserved