This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00003711


Marker Name:  SW491 
Species:  Pig
Marker Type:  Microsatellite
Publication ID: 8743988

PCR Primers

Primer: TTTAAGCCACTGCACCAGG
Primer: CAGGGAACTCCTCATAGTCCC
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00008882

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL52PRE Sscrofa8 Pig Assembly: 5 Pig
chromosome 5
2616159.000 2616245.000 2616331.000
ENSEMBL56 Sscrofa9 Pig Assembly: 5 Pig
chromosome 5
2937632.000 2937718.000 2937804.000
ENSEMBL67 Ssc10.2 Pig Assembly: 5 Pig
chromosome 5
3722572.000 3722658.000 3722744.000
NIAI-Japan QTL v2 (A): 5 Pig
chromosome 5
25.100 25.100 25.100
NIAI-Japan v1 (A): 5 Pig
chromosome 5
24.800 24.800 24.800
NIAI-Japan v1 (F): 5 Pig
chromosome 5
30.100 30.100 30.100
NIAI-Japan v1 (M): 5 Pig
chromosome 5
20.800 20.800 20.800
USDA-MARC v2 (A): 5 Pig
chromosome 5
0.000 0.000 0.000


© The Roslin Institute 2007-2012, all rights reserved