This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00002336


Marker Name:  S0005 
Species:  Pig
Marker Type:  Microsatellite
Publication ID: 7982563

PCR Primers

Primer: TCTTCCCTCCTGGTAACTA
Primer: GCACTTCCTGATTCTGGGTA
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: M97232

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL67 Ssc10.2 Pig Assembly: 5 Pig
chromosome 5
63117217.000 63117335.500 63117454.000
NIAI-Japan QTL v2 (A): 5 Pig
chromosome 5
96.900 96.900 96.900
NIAI-Japan v1 (A): 5 Pig
chromosome 5
93.100 93.100 93.100
NIAI-Japan v1 (F): 5 Pig
chromosome 5
104.900 104.900 104.900
NIAI-Japan v1 (M): 5 Pig
chromosome 5
84.900 84.900 84.900
Nordic v1 (A): 5 Pig
chromosome 5
52.000 52.000 52.000
Nordic v2 (A): 5 Pig
chromosome 5
40.500 40.500 40.500
Nordic v2 (F): 5 Pig
chromosome 5
52.400 52.400 52.400
Nordic v2 (M): 5 Pig
chromosome 5
20.000 20.000 20.000
PiGMaP SSC5 v1.5 (A): 5 Pig
chromosome 5
96.000 96.000 96.000
PiGMaP SSC5 v1.5 (F): 5 Pig
chromosome 5
101.000 101.000 101.000
PiGMaP SSC5 v1.5 (M): 5 Pig
chromosome 5
88.000 88.000 88.000
PiGMaP v1 (A): 5 Pig
chromosome 5
35.000 35.000 35.000
PiGMaP v1 (F): 5 Pig
chromosome 5
30.000 30.000 30.000
PiGMaP v1 (M): 5 Pig
chromosome 5
38.000 38.000 38.000
USDA-MARC v2 (A): 5 Pig
chromosome 5
56.700 56.700 56.700


© The Roslin Institute 2007-2012, all rights reserved