This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00022032


Marker Name:  ETH225 
Species:  Cow
Marker Type:  PCR-STS
Publication ID: 15231756

PCR Primers

Primer: ACATGACAGCCAGCTGCTACT
Primer: GATCACCTTGCCACTATTTCCT
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00007768
has an Associated Sequence: Local Sequence ID: ARKFSQ00001088

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
BovGen_RH (2006): 9 Cow
chromosome 9
277.000 277.000 277.000
ENSEMBL54 Btau_4.0 Cow Assembly: 9 Cow
chromosome 9
9977152.000 9977225.500 9977299.000
ENSEMBL66 UMD3.1 Cow Assembly: 9 Cow
chromosome 9
10858122.000 10858195.500 10858269.000
ILTXRH2004: 9_A Cow
chromosome 9
16.370 16.370 16.370
ILTXRH2005: 9 Cow
chromosome 9
74.000 74.000 74.000
Mckay S.D. et al 2007: 9 Cow
chromosome 9
78.100 78.100 78.100
Snelling, W et al. 2006 (Composite): 9 Cow
chromosome 9
14.100 14.100 14.100


© The Roslin Institute 2007-2012, all rights reserved