This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00006995


Marker Name:  BMS1522 
Species:  Cow
Marker Type:  Microsatellite
Publication ID: 9074927

PCR Primers

Primer: AGAAAATGATGGCAGGAACC
Primer: AGTCCATGGTGTTGAAAGAGTC
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00000019
has an Associated Sequence: Sequence Genbank ID: G18911

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
BovGen_RH (2006): 9 Cow
chromosome 9
665.800 665.800 665.800
ILTXRH2004: 9_A Cow
chromosome 9
167.580 167.580 167.580
ILTXRH2005: 9 Cow
chromosome 9
190.000 190.000 190.000
MARC2004 (A): 9 Cow
chromosome 9
36.542 36.542 36.542
MARC97 (A): 9 Cow
chromosome 9
31.200 31.200 31.200
Snelling, W et al. 2006 (Composite): 9 Cow
chromosome 9
31.500 31.500 36.400


© The Roslin Institute 2007-2012, all rights reserved